|
A previous version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT2G19570.1 | AT | cytidine deaminase 1 | JGI | N/A | IEA |
| GO:0009972 | GO-bp | cytidine deamination | EnsemblGenomes | N/A | IEA |
| GO:0005829 | GO-cc | cytosol | EnsemblGenomes | N/A | IEA |
| GO:0003824 | GO-mf | catalytic activity | EnsemblGenomes | N/A | IEA |
| GO:0004126 | GO-mf | cytidine deaminase activity | EnsemblGenomes | N/A | IEA |
| GO:0008270 | GO-mf | zinc ion binding | EnsemblGenomes | N/A | IEA |
| GO:0008270 | GO-mf | zinc ion binding | JGI | N/A | IEA |
| GO:0016787 | GO-mf | hydrolase activity | EnsemblGenomes | N/A | IEA |
| GO:0016787 | GO-mf | hydrolase activity | JGI | N/A | IEA |
| PTHR11644 | Panther | CYTIDINE DEAMINASE | JGI | N/A | IEA |
| PTHR11644:SF5 | Panther | JGI | N/A | IEA | |
| PF00383 | PFAM | Cytidine and deoxycytidylate deaminase zinc-binding region | JGI | N/A | IEA |
| PWY-6556 | SoyCyc9 | pyrimidine ribonucleosides salvage II | Plant Metabolic Network | ISS | |
| PWY-7193 | SoyCyc9 | pyrimidine ribonucleosides salvage I | Plant Metabolic Network | ISS | |
| PWY-7196 | SoyCyc9 | superpathway of pyrimidine ribonucleosides salvage | Plant Metabolic Network | ISS | |
| PWY-7199 | SoyCyc9 | pyrimidine deoxyribonucleosides salvage | Plant Metabolic Network | ISS | |
| GN7V-59444 | SoyCyc9-rxn | cytidine deaminase | Plant Metabolic Network | ISS |
|
Glyma.04g154700 not represented in the dataset |
Glyma.04g154700 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.
Gene information in GlycineMine developed by LIS.
Gene families from PhyloGenes.
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma04g23996 | Wm82.a1.v1.1 | IGC | As supplied by JGI |
>Glyma.04g154700.1 sequence-type=CDS polypeptide=Glyma.04g154700.1.p locus=Glyma.04g154700 ID=Glyma.04g154700.1.Wm82.a2.v1 annot-version=Wm82.a2.v1 ATGCAGGATGATGCCGCAACCACAACAATGATAGCAGCCGCAATAGCCGATGGAGTCACAATCGCCGAATCCCAATCAATCTCCAAACTCCTCCCTTCCCTCGTTTCCTCTGCTCAATCCCTCGCCTGTCCTTCCATCTCCAACTTTCCCGTCGCCGCCGTCGAACTCGGCACCTCCGGTCACATCTTCGTGGGCGTGAACATGGAGTTCCCAAGCCTCCCCTTCCACCACACCATCCACGCTGAACAGTTCCTCCTCACCAACATGGCCAACAACGTCGAGACCCACCTCGACTCCTTCGCCGTCTCCGCCGCCCCCTGCGGCCATTGCCGCCAGTTCCTTCAAGAACTCCGCGACGCCCCTGACATCCAAATCCTCATCACCTCCCATAAAAACCCTCACTTCAGCCCTCTCTCCCACTTCCTCTTCCACCACTTCGGCCCCCACGACCTTTTCCCCAAAACCGTCCCTCTCCTCTTGGAGCCTCGTCACAACGCTCTCTCTCTTCCCCAAAATGATCATTTCAACGTTCTTGCAAAAGAATTTGAAATTCTTTCATAA
>Glyma.04g154700.1.p sequence-type=predicted peptide transcript=Glyma.04g154700.1 locus=Glyma.04g154700 ID=Glyma.04g154700.1.Wm82.a2.v1 annot-version=Wm82.a2.v1 MQDDAATTTMIAAAIADGVTIAESQSISKLLPSLVSSAQSLACPSISNFPVAAVELGTSGHIFVGVNMEFPSLPFHHTIHAEQFLLTNMANNVETHLDSFAVSAAPCGHCRQFLQELRDAPDIQILITSHKNPHFSPLSHFLFHHFGPHDLFPKTVPLLLEPRHNALSLPQNDHFNVLAKEFEILS*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||