SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma.04g095000

Feature Type:gene_model
Chromosome:Gm04
Start:8470124
stop:8470834
Source:JGI
Version:Wm82.a2.v1
High confidence:yes



A previous version of this gene model can be found here:

Annotations for Glyma.04g095000
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
ATCG00270.1AT photosystem II reaction center protein D JGI N/AIEA
GO:0009772GO-bp photosynthetic electron transport in photosystem II EnsemblGenomesN/AIEA
GO:0009772GO-bp photosynthetic electron transport in photosystem II JGI N/AIEA
GO:0019684GO-bp photosynthesis, light reaction EnsemblGenomesN/AIEA
GO:0019684GO-bp photosynthesis, light reaction JGI N/AIEA
GO:0016020GO-cc membrane EnsemblGenomesN/AIEA
GO:0016021GO-cc integral component of membrane EnsemblGenomesN/AIEA
GO:0045156GO-mf electron transporter, transferring electrons within the cyclic electron transport pathway of photosynthesis activity EnsemblGenomesN/AIEA
GO:0045156GO-mf electron transporter, transferring electrons within the cyclic electron transport pathway of photosynthesis activity JGI N/AIEA
PF00124PFAM Photosynthetic reaction centre protein JGI N/AIEA
PHOTOALL-PWYSoyCyc9 oxygenic photosynthesis Plant Metabolic Network ISS
PWY-101SoyCyc9 photosynthesis light reactions Plant Metabolic Network ISS
GN7V-46422SoyCyc9-rxn photosystem II Plant Metabolic Network ISS

Expression Patterns of Glyma.04g095000
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma.04g095000 not represented in the dataset
Glyma.04g095000 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

View a gene family containing related genes from other legumes at LIS

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.


View gene and ortholog information at GlycineMine

Gene information in GlycineMine developed by LIS.


Related Plant Genes

View a gene family containing related genes from other plant species at PhyloGenes

Gene families from PhyloGenes.


Gene model name correspondences to Glyma.04g095000 Gene Call Version Wm82.a2.v1
Corresponding NameAnnotation VersionEvidenceComments
Glyma04g10151 Wm82.a1.v1.1IGC As supplied by JGI


Coding sequences of Glyma.04g095000
>Glyma.04g095000.1 sequence-type=CDS polypeptide=Glyma.04g095000.1.p locus=Glyma.04g095000 ID=Glyma.04g095000.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGATGGGAGTTGCTGGTGTATTGGGCACGACACTACTATGCGTTATTCATGGTGCCACCGTAGAAAATACTTTATTTGAAGATGGTGATGGCGCAAATACATTCCGTGCTTTTAACTCAACCCAAGCTGAAGAAACTTATTCAATGGTTACTGCTAATCGCTTTTGGTCCCAAATCTTTGGGGTTGCTTTTTCCAATAAACGTTGGTTACATGTCTTTATGTTATTTGTACCAGTAACTGGTTTATGGATGAGTGCTCTTGGGGTAGTCGATTTGGCCCTGAACCTACGTGCCTATGACTTCGTTTCTCAAGAAATCCGCGCAGCGGAAGATCCTGAATTTGAGACTTTCTACATCAATAATATTCTCTTAAACGAAGGTATTCGTGCATGGATGGCAGCTCAAGATCAGCCTCATGAAAACCTTATATTCCCTGAGGAGGTTCTATAG
Predicted protein sequences of Glyma.04g095000
>Glyma.04g095000.1.p sequence-type=predicted peptide transcript=Glyma.04g095000.1 locus=Glyma.04g095000 ID=Glyma.04g095000.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MMGVAGVLGTTLLCVIHGATVENTLFEDGDGANTFRAFNSTQAEETYSMVTANRFWSQIFGVAFSNKRWLHVFMLFVPVTGLWMSALGVVDLALNLRAYDFVSQEIRAAEDPEFETFYINNILLNEGIRAWMAAQDQPHENLIFPEEVL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo