|
A previous version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT3G58610.1 | AT | ketol-acid reductoisomerase | JGI | N/A | IEA |
| GO:0008652 | GO-bp | cellular amino acid biosynthetic process | EnsemblGenomes | N/A | IEA |
| GO:0009082 | GO-bp | branched-chain amino acid biosynthetic process | EnsemblGenomes | N/A | IEA |
| GO:0009082 | GO-bp | branched-chain amino acid biosynthetic process | JGI | N/A | IEA |
| GO:0009097 | GO-bp | isoleucine biosynthetic process | EnsemblGenomes | N/A | IEA |
| GO:0009099 | GO-bp | valine biosynthetic process | EnsemblGenomes | N/A | IEA |
| GO:0055114 | GO-bp | oxidation-reduction process | EnsemblGenomes | N/A | IEA |
| GO:0055114 | GO-bp | oxidation-reduction process | JGI | N/A | IEA |
| GO:0004455 | GO-mf | ketol-acid reductoisomerase activity | EnsemblGenomes | N/A | IEA |
| GO:0004455 | GO-mf | ketol-acid reductoisomerase activity | JGI | N/A | IEA |
| GO:0016491 | GO-mf | oxidoreductase activity | EnsemblGenomes | N/A | IEA |
| PTHR21371 | Panther | FAMILY NOT NAMED | JGI | N/A | IEA |
| PTHR21371:SF4 | Panther | JGI | N/A | IEA | |
| PF01450 | PFAM | Acetohydroxy acid isomeroreductase, catalytic domain | JGI | N/A | IEA |
| BRANCHED-CHAIN-AA-SYN-PWY | SoyCyc9 | superpathway of branched chain amino acid biosynthesis | Plant Metabolic Network | ISS | |
| VALSYN-PWY | SoyCyc9 | L-valine biosynthesis | Plant Metabolic Network | ISS | |
| GN7V-61743 | SoyCyc9-rxn | ketol-acid reductoisomerase | Plant Metabolic Network | ISS |
|
Glyma.04G181400 not represented in the dataset |
Glyma.04G181400 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.
Gene information in GlycineMine developed by LIS.
Gene families from PhyloGenes.
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.04g181400 | Wm82.a4.v1 | ISS | As supplied by JGI |
| Glyma04g35256 | Wm82.a1.v1.1 | IGC | As supplied by JGI |
>Glyma.04g181400.1 sequence-type=CDS polypeptide=Glyma.04g181400.1.p locus=Glyma.04g181400 ID=Glyma.04g181400.1.Wm82.a2.v1 annot-version=Wm82.a2.v1 ATGGAATACAGGAGTCACATCTTTCGGGAGAGAGGCATTTTACTTAGGGCTGTTCATGGTATTGTGGAATCCTTGTTTAGGAGGTACACTGAAAATGGAATGAGTGAAGATTTGGCCTATAACAACACTGTCGAGCCCATTACAAGAACTATATCTAAAATAATCTCGACTAAGGGTATGGAATTTGAGAAAGCATATAGTGCTTCATATTATTCCTGCATGGACATTTTGTATGCGTGCTATGAGGATATTGCTGCTAGAAGTGACATTCGCAGTGTTGTCTTGGATGGGCGGAACTTTTATGTATGTACGTTGCTTGCATTTCCCATGGGTAAAATTGATCAGACCCTGATGTGGAAGGTTGGTTAG
>Glyma.04g181400.1.p sequence-type=predicted peptide transcript=Glyma.04g181400.1 locus=Glyma.04g181400 ID=Glyma.04g181400.1.Wm82.a2.v1 annot-version=Wm82.a2.v1 MEYRSHIFRERGILLRAVHGIVESLFRRYTENGMSEDLAYNNTVEPITRTISKIISTKGMEFEKAYSASYYSCMDILYACYEDIAARSDIRSVVLDGRNFYVCTLLAFPMGKIDQTLMWKVG*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||