|
A previous version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT1G26670.1 | AT | Vesicle transport v-SNARE family protein | JGI | N/A | IEA |
| GO:0006623 | GO-bp | protein targeting to vacuole | EnsemblGenomes | N/A | IEA |
| GO:0006888 | GO-bp | ER to Golgi vesicle-mediated transport | EnsemblGenomes | N/A | IEA |
| GO:0006891 | GO-bp | intra-Golgi vesicle-mediated transport | EnsemblGenomes | N/A | IEA |
| GO:0006896 | GO-bp | Golgi to vacuole transport | EnsemblGenomes | N/A | IEA |
| GO:0042147 | GO-bp | retrograde transport, endosome to Golgi | EnsemblGenomes | N/A | IEA |
| GO:0048280 | GO-bp | vesicle fusion with Golgi apparatus | EnsemblGenomes | N/A | IEA |
| GO:0005789 | GO-cc | endoplasmic reticulum membrane | EnsemblGenomes | N/A | IEA |
| GO:0005794 | GO-cc | Golgi apparatus | EnsemblGenomes | N/A | IEA |
| GO:0005829 | GO-cc | cytosol | EnsemblGenomes | N/A | IEA |
| GO:0012507 | GO-cc | ER to Golgi transport vesicle membrane | EnsemblGenomes | N/A | IEA |
| GO:0031201 | GO-cc | SNARE complex | EnsemblGenomes | N/A | IEA |
| GO:0031902 | GO-cc | late endosome membrane | EnsemblGenomes | N/A | IEA |
| GO:0000149 | GO-mf | SNARE binding | EnsemblGenomes | N/A | IEA |
| GO:0005484 | GO-mf | SNAP receptor activity | EnsemblGenomes | N/A | IEA |
| PTHR21230 | Panther | VESICLE TRANSPORT V-SNARE PROTEIN VTI1-RELATED | JGI | N/A | IEA |
| PTHR21230:SF16 | Panther | JGI | N/A | IEA | |
| PF12352 | PFAM | Snare region anchored in the vesicle membrane C-terminus | JGI | N/A | IEA |
|
Glyma.04G166200 not represented in the dataset |
Glyma.04G166200 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.
Gene information in GlycineMine developed by LIS.
Gene families from PhyloGenes.
| Paralog | Evidence | Comments |
|---|---|---|
| Glyma.06g196300 | IGC | Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35. |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.04g166200 | Wm82.a4.v1 | ISS | As supplied by JGI |
| Glyma04g33095 | Wm82.a1.v1.1 | IGC | As supplied by JGI |
>Glyma.04g166200.1 sequence-type=CDS polypeptide=Glyma.04g166200.1.p locus=Glyma.04g166200 ID=Glyma.04g166200.1.Wm82.a2.v1 annot-version=Wm82.a2.v1 ATGGCATCAAATGATCAAAAAGGAAGACTTCTGATTTCTACTGAAAGACTTAATCAATCCACTGACAGAATAAAGGAGAGCAGAAAAACAATGCTAGAGAAAGAGGATCTTGGTGAATTTATCCTCCGAGATTTGCATCAACAACGTGAATCCCTACTCCACGCCAATAAGACGGGCATGGATGATAACATTAGCAAGAGCAAGAAGATTTTGTCGGCCATGTCAAGAAGGATGAGCAGGAACAAAGGATTGTTGGCTCCTCAATGA
>Glyma.04g166200.1.p sequence-type=predicted peptide transcript=Glyma.04g166200.1 locus=Glyma.04g166200 ID=Glyma.04g166200.1.Wm82.a2.v1 annot-version=Wm82.a2.v1 MASNDQKGRLLISTERLNQSTDRIKESRKTMLEKEDLGEFILRDLHQQRESLLHANKTGMDDNISKSKKILSAMSRRMSRNKGLLAPQ*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||