SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma.03g193800): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma.03g193800): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma.03g193800

Feature Type:gene_model
Chromosome:Gm03
Start:40458061
stop:40461275
Source:JGI
Version:Wm82.a2.v1
High confidence:yes



A previous version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G36310.1AT uridine-ribohydrolase 1 JGI N/AIEA
GO:0006152GO-bp purine nucleoside catabolic process EnsemblGenomesN/AIEA
GO:0005829GO-cc cytosol EnsemblGenomesN/AIEA
GO:0008477GO-mf purine nucleosidase activity EnsemblGenomesN/AIEA
KOG2938 KOG Predicted inosine-uridine preferring nucleoside hydrolase JGI N/AIEA
PTHR12304Panther INOSINE-URIDINE PREFERRING NUCLEOSIDE HYDROLASE JGI N/AIEA
PF01156PFAM Inosine-uridine preferring nucleoside hydrolase JGI N/AIEA
P165-PWYSoyCyc9 superpathway of purines degradation in plants Plant Metabolic Network ISS
PWY-5043SoyCyc9 purine nucleosides salvage II (plant) Plant Metabolic Network ISS
PWY-5044SoyCyc9 purine nucleotides degradation I (plants) Plant Metabolic Network ISS
PWY-6556SoyCyc9 pyrimidine ribonucleosides salvage II Plant Metabolic Network ISS
PWY-6595SoyCyc9 superpathway of guanosine nucleotides degradation (plants) Plant Metabolic Network ISS
PWY-6596SoyCyc9 adenosine nucleotides degradation I Plant Metabolic Network ISS
PWY-6605SoyCyc9 adenine and adenosine salvage II Plant Metabolic Network ISS
PWY-6607SoyCyc9 guanosine nucleotides degradation I Plant Metabolic Network ISS
PWY-7196SoyCyc9 superpathway of pyrimidine ribonucleosides salvage Plant Metabolic Network ISS
PWYQT-4445SoyCyc9 pyrimidine salvage pathway Plant Metabolic Network ISS
GN7V-61839SoyCyc9-rxn purine nucleosidase Plant Metabolic Network ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma.03g193800 not represented in the dataset

Glyma.03g193800 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE


View a gene family containing related genes from other legumes at LIS

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.


View gene and ortholog information at GlycineMine

Gene information in GlycineMine developed by LIS.



View a gene family containing related genes from other plant species at PhyloGenes

Gene families from PhyloGenes.


ParalogEvidenceComments
Glyma.19g193700 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.

Corresponding NameAnnotation VersionEvidenceComments
Glyma03g35166 Wm82.a1.v1.1IGC As supplied by JGI


>Glyma.03g193800.1 sequence-type=CDS polypeptide=Glyma.03g193800.1.p locus=Glyma.03g193800 ID=Glyma.03g193800.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGGCCATTCTTATGGCTTTTCAAAGTCCAGATGTGGAGGTTCTGGGTTTGACAACCATTTTTGGTAATACAACTACCGAACTTTCAACACTCAATGCTTTGCTTTTGTGTGAGATGGCAGGCCGTGAAGATATTCCAGTTGCACAGGGAAGCCATGAGCCATTGAAGGGTGGAAAGCCTCGTGTTGCTGATTTTGTTCATGGTAAAGATGGACTAGGGAACACATTCCTACCCCCACCTAAAGGTGAGAAAATTGAGAAAAGTGCTAGTGAGTTTTTGGTAGAGAAAGTCTCTGAATATCCTGGTGAAGTATCTGTGCTAGCACTTGGACCACTAACAAATTTGGCTTTGGCAATCAAAAGGGATTCTTCCTTTGCAAGCAAAGTGAAGAGAATAGTTATACTTGGTGGTGCATTCTTTGCCTTGGGGAATGTGAATCCTGCTGCAGAAGCCAATATCCATGGAGACCCGGAAGCCGCAGATATTGTGTTTACCTCTGGGGCAGATATTGTTGTTATTGGAATAAACATTACAACCCAAGTCCAATTCACAGATGCTGATCTCCTCGAACTGAAGGAATCTAAAGGAAAGTATGCTCCCTTCTTGAGTGACATATGCAAATTCTATAGGGACTTTCATGTAAAATCTGATGGTGTCCACGGAATTTTCCTCCACGATCCTGTAAGTTTTGTGGCAGTTGTGCGTCCAGATCTTTTCACATACAAGAAGGGGGTAGTGAGGGTAGAAACACAAGGCATCTGTGTTGGGCATACACTTATGGACCAAGGATTGAAAAAGTTTGTCCAAATTTACAACTACTATTATTATGCACTTTTTTTTTGTTAA

>Glyma.03g193800.1.p sequence-type=predicted peptide transcript=Glyma.03g193800.1 locus=Glyma.03g193800 ID=Glyma.03g193800.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MAILMAFQSPDVEVLGLTTIFGNTTTELSTLNALLLCEMAGREDIPVAQGSHEPLKGGKPRVADFVHGKDGLGNTFLPPPKGEKIEKSASEFLVEKVSEYPGEVSVLALGPLTNLALAIKRDSSFASKVKRIVILGGAFFALGNVNPAAEANIHGDPEAADIVFTSGADIVVIGINITTQVQFTDADLLELKESKGKYAPFLSDICKFYRDFHVKSDGVHGIFLHDPVSFVAVVRPDLFTYKKGVVRVETQGICVGHTLMDQGLKKFVQIYNYYYYALFFC*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo