SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma.03g158800

Feature Type:gene_model
Chromosome:Gm03
Start:37411076
stop:37418391
Source:JGI
Version:Wm82.a2.v1
High confidence:yes



A previous version of this gene model can be found here:

Annotations for Glyma.03g158800
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G03030.1AT P-loop containing nucleoside triphosphate hydrolases superfamily protein JGI N/AIEA
GO:0006206GO-bp pyrimidine nucleobase metabolic process EnsemblGenomesN/AIEA
GO:0006222GO-bp UMP biosynthetic process EnsemblGenomesN/AIEA
GO:0008152GO-bp metabolic process JGI N/AIEA
GO:0043097GO-bp pyrimidine nucleoside salvage EnsemblGenomesN/AIEA
GO:0005829GO-cc cytosol EnsemblGenomesN/AIEA
GO:0004849GO-mf uridine kinase activity EnsemblGenomesN/AIEA
GO:0005524GO-mf ATP binding JGI N/AIEA
GO:0016301GO-mf kinase activity JGI N/AIEA
PTHR10285Panther URIDINE KINASE JGI N/AIEA
PTHR10285:SF29Panther JGI N/AIEA
PF00485PFAM Phosphoribulokinase / Uridine kinase family JGI N/AIEA
PWY-7193SoyCyc9 pyrimidine ribonucleosides salvage I Plant Metabolic Network ISS
PWY-7196SoyCyc9 superpathway of pyrimidine ribonucleosides salvage Plant Metabolic Network ISS
GN7V-66851SoyCyc9-rxn uridine kinase Plant Metabolic Network ISS

Expression Patterns of Glyma.03g158800
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma.03g158800 not represented in the dataset
Glyma.03g158800 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

View a gene family containing related genes from other legumes at LIS

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.


View gene and ortholog information at GlycineMine

Gene information in GlycineMine developed by LIS.


Related Plant Genes

View a gene family containing related genes from other plant species at PhyloGenes

Gene families from PhyloGenes.


Paralogs of Glyma.03g158800
ParalogEvidenceComments
Glyma.19g161200 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.

Gene model name correspondences to Glyma.03g158800 Gene Call Version Wm82.a2.v1
Corresponding NameAnnotation VersionEvidenceComments
Glyma03g31545 Wm82.a1.v1.1IGC As supplied by JGI


Coding sequences of Glyma.03g158800
>Glyma.03g158800.1 sequence-type=CDS polypeptide=Glyma.03g158800.1.p locus=Glyma.03g158800 ID=Glyma.03g158800.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
CGTGTTGATGAGTTATATGATACATTGGTTACACGTCTTCTGCCTTCAGTGTCAGTGTCATCAAATCCTAATCACAAGCTTTTAGTTGGGCTGGCTGGTCCTCCTGGTGCTGGAAAAAGCACTCTAGCACATGAAGTAGCCAGACGTATAAACAAACTTTGGCCAGAGAAAGCTTCTTCCTTTGACTCTCTGGTTGAACCTCCAGATGTTGCTATTGTGGTTCCCATGGATGGTTTTCATCTTTATCGTTTTGAACTAGACGCAATGGAGAATCTCGAGGAAGCACATGCCAGAAGGGGAGCTCCCTGGACATTCAATCCATTGGGACTACTTACATATCTCAAGAATCTGAGAAGTCATGGATCAGTTTATGTACCATCATTTGACCATGGTGTTGGGGACCCAGTTAAGATGCTCAAGGTTGTTATTGTAGAAGGTAACTATTTGCTCTTGGAAGATGGGCAATGGAAGGAGATATCTTCTTTGTTTGACGAGAAATGGCAAGCATTGATTTTACCAAGGCATATGTATATTGATATTGACATTGACGAAGCAATGCAGCGAGTTTTAAAGAGGCATATTTCAACTGGCAAGCCTCCAGACATTGCTAAACAGCGGATGGAGAACAACGACAGTCTTAATGCAGAACTTATAATGAAGTCCAAGAAAAATGCTGATATAATAATCGAGTCAGTTGATTTCTGA
Predicted protein sequences of Glyma.03g158800
>Glyma.03g158800.1.p sequence-type=predicted peptide transcript=Glyma.03g158800.1 locus=Glyma.03g158800 ID=Glyma.03g158800.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
RVDELYDTLVTRLLPSVSVSSNPNHKLLVGLAGPPGAGKSTLAHEVARRINKLWPEKASSFDSLVEPPDVAIVVPMDGFHLYRFELDAMENLEEAHARRGAPWTFNPLGLLTYLKNLRSHGSVYVPSFDHGVGDPVKMLKVVIVEGNYLLLEDGQWKEISSLFDEKWQALILPRHMYIDIDIDEAMQRVLKRHISTGKPPDIAKQRMENNDSLNAELIMKSKKNADIIIESVDF*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo