SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma.02g244000

Feature Type:gene_model
Chromosome:Gm02
Start:43200089
stop:43204490
Source:JGI
Version:Wm82.a2.v1
High confidence:yes



A previous version of this gene model can be found here:

Annotations for Glyma.02g244000
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G37600.1AT glutamine synthase clone R1 JGI N/AIEA
GO:0006542GO-bp glutamine biosynthetic process EnsemblGenomesN/AIEA
GO:0006542GO-bp glutamine biosynthetic process JGI N/AIEA
GO:0006807GO-bp nitrogen compound metabolic process EnsemblGenomesN/AIEA
GO:0006807GO-bp nitrogen compound metabolic process JGI N/AIEA
GO:0000166GO-mf nucleotide binding EnsemblGenomesN/AIEA
GO:0003824GO-mf catalytic activity EnsemblGenomesN/AIEA
GO:0004356GO-mf glutamate-ammonia ligase activity EnsemblGenomesN/AIEA
GO:0004356GO-mf glutamate-ammonia ligase activity JGI N/AIEA
GO:0005524GO-mf ATP binding EnsemblGenomesN/AIEA
GO:0016874GO-mf ligase activity EnsemblGenomesN/AIEA
KOG0683 KOG Glutamine synthetase JGI N/AIEA
PTHR20852Panther GLUTAMINE SYNTHETASE JGI N/AIEA
PTHR20852:SF14Panther GLUTAMINE SYNTHETASE 2 CYTOPLASMIC JGI N/AIEA
PF00120PFAM Glutamine synthetase, catalytic domain JGI N/AIEA
PF03951PFAM Glutamine synthetase, beta-Grasp domain JGI N/AIEA
GLNSYN-PWYSoyCyc9 L-glutamine biosynthesis I Plant Metabolic Network ISS
PWY-3282SoyCyc9 superpathway of ammonia assimilation (plants) Plant Metabolic Network ISS
PWY-381SoyCyc9 nitrate reduction II (assimilatory) Plant Metabolic Network ISS
PWY-6549SoyCyc9 L-glutamine biosynthesis III Plant Metabolic Network ISS
PWY-6963SoyCyc9 ammonia assimilation cycle I Plant Metabolic Network ISS
PWY-6964SoyCyc9 ammonia assimilation cycle II Plant Metabolic Network ISS
PWY-7060SoyCyc9 ornithine-citrulline shuttle Plant Metabolic Network ISS
GN7V-56833SoyCyc9-rxn glutamate-ammonia ligase Plant Metabolic Network ISS

Proteins Associated with Glyma.02g244000
LocusGene SymbolProtein Name
GS-gamma2-a Gamma glutamine synthase 2 gene
GS1GAMMA2 glutamine synthetase cytosolic isozyme 2
GS glutamine synthetase

Expression Patterns of Glyma.02g244000
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

View a gene family containing related genes from other legumes at LIS

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.


View gene and ortholog information at GlycineMine

Gene information in GlycineMine developed by LIS.


Related Plant Genes

View a gene family containing related genes from other plant species at PhyloGenes

Gene families from PhyloGenes.


Paralogs of Glyma.02g244000
ParalogEvidenceComments
Glyma.14g213300 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.

Gene model name correspondences to Glyma.02g244000 Gene Call Version Wm82.a2.v1
Corresponding NameAnnotation VersionEvidenceComments
Glyma02g41120 Wm82.a1.v1.1IGC As supplied by JGI


Coding sequences of Glyma.02g244000
>Glyma.02g244000.1 sequence-type=CDS polypeptide=Glyma.02g244000.1.p locus=Glyma.02g244000 ID=Glyma.02g244000.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGTCGTTACTCTCCGATCTTATCAACCTTAACCTCTCCGACATCACCGATAAGGTGATCGCCGAGTACATATGGGTTGGTGGATCTGGCATGGATATGAGGAGCAAAGCAAGGACTCTCTCGGGACTGGTTAATGACCCTTCCAAGCTTCCCAAGTGGAACTATGATGGTTCCAGCACTGGTCAAGCTCCTGGACAAGATAGTGAAGTGATCTTATATCCACAAGCAATTTTTCGGGATCCATTCAGGAGGGGTAACAATATCCTGGTTATGTGTGATGCTTACACTCCTGCTGGGGAACCCATTCCTACCAACAAGAGAAATAAAGCTGCAAAGATATTCAGTAATCCGGATGTTGCTGCTGAAGAACCCTGGTATGGTCTTGAGCAGGAATATACATTATTGCAGAAAGATGTCCAATGGCCTCTTGGATGGCCTCTTGGTGGGTTTCCTGGGCCCCAGGGACCATACTATTGTGGAACTGGTGCTAACAAGGCTTTTGGGCGTGATATTGTTGACTCACATTACAAAGCATGTATTTATGCGGGAATTAACATAAGTGGAATCAATGGAGAAGTGATGCCCGGTCAGTGGGAATTCCAAGTTGGTCCATCGGTTGGCATCTCTGCTGCTGACGAGTTGTGGGTTGCTCGTTACATTTTGGAGAGGATCACCGAGATTGCTGGAGTGGTGCTTTCCTTTGACCCTAAACCAATTCAGGGTGATTGGAATGGTGCTGGTGCTCACACAAATTACAGTACCAAGTTGATGAGAAACGATGGTGGCTATGAAATCATCAAAAAAGCAATTGCTAAGTTGGAAAAGAGGCACAAAGAGCACATTGCTGCTTACGGAGAAGGCAATGAACGTCGTTTGACCGGACGACACGAGACGGCTGACATGAACACCTTTTTATGGGGTGTTGCAAACCGTGGTGCTTCTATTAGGGTAGGGAGAGACACTGAAAAGGCAGGGAAGGGATACTTTGAAGATAGGAGGCCTGCCTCTAACATGGACCCTTATGTGGTCACTTCCATGATTGCTGAGACAACTATTCTTTGGAAACCATAA
Predicted protein sequences of Glyma.02g244000
>Glyma.02g244000.1.p sequence-type=predicted peptide transcript=Glyma.02g244000.1 locus=Glyma.02g244000 ID=Glyma.02g244000.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MSLLSDLINLNLSDITDKVIAEYIWVGGSGMDMRSKARTLSGLVNDPSKLPKWNYDGSSTGQAPGQDSEVILYPQAIFRDPFRRGNNILVMCDAYTPAGEPIPTNKRNKAAKIFSNPDVAAEEPWYGLEQEYTLLQKDVQWPLGWPLGGFPGPQGPYYCGTGANKAFGRDIVDSHYKACIYAGINISGINGEVMPGQWEFQVGPSVGISAADELWVARYILERITEIAGVVLSFDPKPIQGDWNGAGAHTNYSTKLMRNDGGYEIIKKAIAKLEKRHKEHIAAYGEGNERRLTGRHETADMNTFLWGVANRGASIRVGRDTEKAGKGYFEDRRPASNMDPYVVTSMIAETTILWKP*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo