SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma.02g154400): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma.02g154400): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma.02g154400

Feature Type:gene_model
Chromosome:Gm02
Start:15832224
stop:15833613
Source:JGI
Version:Wm82.a2.v1
High confidence:yes



A previous version of this gene model can be found here:

Annotations for Glyma.02g154400
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G02920.1AT glutathione S-transferase 7 JGI N/AIEA
GO:0006749GO-bp glutathione metabolic process EnsemblGenomesN/AIEA
GO:0006952GO-bp defense response EnsemblGenomesN/AIEA
GO:0009409GO-bp response to cold EnsemblGenomesN/AIEA
GO:0009651GO-bp response to salt stress EnsemblGenomesN/AIEA
GO:0042742GO-bp defense response to bacterium EnsemblGenomesN/AIEA
GO:0080167GO-bp response to karrikin EnsemblGenomesN/AIEA
GO:0005634GO-cc nucleus EnsemblGenomesN/AIEA
GO:0005737GO-cc cytoplasm EnsemblGenomesN/AIEA
GO:0005774GO-cc vacuolar membrane EnsemblGenomesN/AIEA
GO:0009507GO-cc chloroplast EnsemblGenomesN/AIEA
GO:0009570GO-cc chloroplast stroma EnsemblGenomesN/AIEA
GO:0009579GO-cc thylakoid EnsemblGenomesN/AIEA
GO:0009941GO-cc chloroplast envelope EnsemblGenomesN/AIEA
GO:0010319GO-cc stromule EnsemblGenomesN/AIEA
GO:0004364GO-mf glutathione transferase activity EnsemblGenomesN/AIEA
GO:0005515GO-mf protein binding EnsemblGenomesN/AIEA
GO:0005515GO-mf protein binding JGI N/AIEA
GO:0016740GO-mf transferase activity EnsemblGenomesN/AIEA
GO:0043295GO-mf glutathione binding EnsemblGenomesN/AIEA
KOG0867 KOG Glutathione S-transferase JGI N/AIEA
PTHR11260Panther GLUTATHIONE S-TRANSFERASE, GST, SUPERFAMILY, GST DOMAIN CONTAINING JGI N/AIEA
PTHR11260:SF55Panther JGI N/AIEA
PF00043PFAM Glutathione S-transferase, C-terminal domain JGI N/AIEA
PF02798PFAM Glutathione S-transferase, N-terminal domain JGI N/AIEA
GN7V-64254SoyCyc9-rxn glutathione transferase Plant Metabolic Network ISS

Proteins Associated with Glyma.02g154400
LocusGene SymbolProtein Name
GSTF2 glutathione S-transferase F2

Expression Patterns of Glyma.02g154400
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma.02g154400 not represented in the dataset
Glyma.02g154400 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

View a gene family containing related genes from other legumes at LIS

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.


View gene and ortholog information at GlycineMine

Gene information in GlycineMine developed by LIS.


Related Plant Genes

View a gene family containing related genes from other plant species at PhyloGenes

Gene families from PhyloGenes.


Gene model name correspondences to Glyma.02g154400 Gene Call Version Wm82.a2.v1
Corresponding NameAnnotation VersionEvidenceComments
Glyma02g17340 Wm82.a1.v1.1IGC As supplied by JGI


Coding sequences of Glyma.02g154400
>Glyma.02g154400.1 sequence-type=CDS polypeptide=Glyma.02g154400.1.p locus=Glyma.02g154400 ID=Glyma.02g154400.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGGCAACAATAAGACTTCATGGAAACCCCTTCTCAACAGCCACCATGCGAGCTGCTGCTTCCCTACACGAGAAGCAGCTTGAATTTGAGTTTGTTCTCATTGACATGAAAAATGGTGAACACAAAAAGGAACCCTTCATTTCCCTTAATCCTTTCGGTCAAGTTCCAGCCTTTGAAGATGGAGATTTGAAGCTCTTTGAATCAAGAGCAATAACTCAGTACATCGTTCACGAGTATGCTGATAAGGGGACTCAACTGATAAGCAAGGAGTCCAAGAAGATGGCAAAATTGAGGTTGTGGTTGGAAGTAGAGAGCCAACACTACGATCAACCAGCTTCAAAACTTGTATGGGAGCTCATGGTAAAGCCTATGTATGGTCTCCCTACGGATCCAGCAGCTGTGGAAGAGAATGAAGGGAAGCTAGGCACTGTTCTTGATTTCTACGAGAAAACATTGTCTCAGTCCAAATACGTGGCGGGTGAGTGTTTCACCTTGGCGGATCTGCATCACCTCCCAACGATTCATTACTTGATGAAAACACAGAGCAAGAAGTTGTTTGAATCACGACCCCATGTTGGTGCATGGGTGGCTGATATTACAGCAAGAACAGCTTGGTCTAAGGTCCTTGCCATGCAGCCTTTGCTAAGTAGTAAATAG
Predicted protein sequences of Glyma.02g154400
>Glyma.02g154400.1.p sequence-type=predicted peptide transcript=Glyma.02g154400.1 locus=Glyma.02g154400 ID=Glyma.02g154400.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MATIRLHGNPFSTATMRAAASLHEKQLEFEFVLIDMKNGEHKKEPFISLNPFGQVPAFEDGDLKLFESRAITQYIVHEYADKGTQLISKESKKMAKLRLWLEVESQHYDQPASKLVWELMVKPMYGLPTDPAAVEENEGKLGTVLDFYEKTLSQSKYVAGECFTLADLHHLPTIHYLMKTQSKKLFESRPHVGAWVADITARTAWSKVLAMQPLLSSK*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo