|
A previous version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT4G36830.1 | AT | GNS1/SUR4 membrane protein family | JGI | N/A | IEA |
| GO:0019367 | GO-bp | fatty acid elongation, saturated fatty acid | EnsemblGenomes | N/A | IEA |
| GO:0030148 | GO-bp | sphingolipid biosynthetic process | EnsemblGenomes | N/A | IEA |
| GO:0034625 | GO-bp | fatty acid elongation, monounsaturated fatty acid | EnsemblGenomes | N/A | IEA |
| GO:0034626 | GO-bp | fatty acid elongation, polyunsaturated fatty acid | EnsemblGenomes | N/A | IEA |
| GO:0042761 | GO-bp | very long-chain fatty acid biosynthetic process | EnsemblGenomes | N/A | IEA |
| GO:0016020 | GO-cc | membrane | EnsemblGenomes | N/A | IEA |
| GO:0016021 | GO-cc | integral component of membrane | EnsemblGenomes | N/A | IEA |
| GO:0016021 | GO-cc | integral component of membrane | JGI | N/A | IEA |
| GO:0030176 | GO-cc | integral component of endoplasmic reticulum membrane | EnsemblGenomes | N/A | IEA |
| GO:0009922 | GO-mf | fatty acid elongase activity | EnsemblGenomes | N/A | IEA |
| KOG3071 | KOG | Fatty acyl-CoA elongase/Polyunsaturated fatty acid specific elongation enzyme | JGI | N/A | IEA |
| PTHR11157 | Panther | FATTY ACID ACYL TRANSFERASE-RELATED | JGI | N/A | IEA |
| PTHR11157:SF3 | Panther | JGI | N/A | IEA | |
| PF01151 | PFAM | GNS1/SUR4 family | JGI | N/A | IEA |
| PWY-1121 | SoyCyc9 | suberin monomers biosynthesis | Plant Metabolic Network | ISS | |
| PWY-321 | SoyCyc9 | cutin biosynthesis | Plant Metabolic Network | ISS | |
| PWY-5080 | SoyCyc9 | very long chain fatty acid biosynthesis I | Plant Metabolic Network | ISS | |
| PWY-5136 | SoyCyc9 | fatty acid β-oxidation II (peroxisome) | Plant Metabolic Network | ISS | |
| PWY-5143 | SoyCyc9 | long-chain fatty acid activation | Plant Metabolic Network | ISS | |
| PWY-5147 | SoyCyc9 | oleate biosynthesis I (plants) | Plant Metabolic Network | ISS | |
| PWY-5156 | SoyCyc9 | superpathway of fatty acid biosynthesis II (plant) | Plant Metabolic Network | ISS | |
| PWY-561 | SoyCyc9 | superpathway of glyoxylate cycle and fatty acid degradation | Plant Metabolic Network | ISS | |
| PWY-5971 | SoyCyc9 | palmitate biosynthesis II (bacteria and plants) | Plant Metabolic Network | ISS | |
| PWY-5989 | SoyCyc9 | stearate biosynthesis II (bacteria and plants) | Plant Metabolic Network | ISS | |
| PWY-6733 | SoyCyc9 | sporopollenin precursors biosynthesis | Plant Metabolic Network | ISS | |
| PWY-6803 | SoyCyc9 | phosphatidylcholine acyl editing | Plant Metabolic Network | ISS | |
| GN7V-65556 | SoyCyc9-rxn | Enzyme name not determined | Plant Metabolic Network | ISS |
|
Glyma.02G059300 not represented in the dataset |
Glyma.02G059300 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.
Gene information in GlycineMine developed by LIS.
Gene families from PhyloGenes.
| Paralog | Evidence | Comments |
|---|---|---|
| Glyma.16g142200 | IGC | Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35. |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.02g059300 | Wm82.a4.v1 | ISS | As supplied by JGI |
| Glyma02g06620 | Wm82.a1.v1.1 | IGC | As supplied by JGI |
>Glyma.02g059300.1 sequence-type=CDS polypeptide=Glyma.02g059300.1.p locus=Glyma.02g059300 ID=Glyma.02g059300.1.Wm82.a2.v1 annot-version=Wm82.a2.v1 ATGATCCTAATCTACTACCTCTCGGAGCACCCGGCTATCGTGGGCTTCCGGTGGAGCCACGCCCAATCATGGGGAGCCACCTGGTCCTTCCTCTTCACCTCAATCGCCTCCTACCTCTTCCTCTCAATCCTCCTCCACCTCTCTCTTTCTCTCCTCTTCCGCCGCCGTCAAATCCCTCTTGGCCCATTCCCCGCCGTCCACAGCCTCTCCATGTCCCTCGTCTCCGCCACGATCTTCGCCGGCATCCTCCTCTCTTCCGCCGCCGAGATCCGCGACACGCGGTGGTTCTGGCCGCGCTCCAAAACCCCCTTACAGTGGCTCCTCTGCTTCCCCCTCGGCACGCGCCCCTCGGGGCGCGTGTTCTTCTGGTCCTACGTCTACTACCTCTCCCACTTCCTCCACATGTTCCGCACTCTCCTCACAATCGTACGCCACCGCAGGCTATCCTTTTTTCATCTGCTTAGCCACTCAATCTCCGCCTTCGCCTCCTTTCTCTGGCTCGAGTTCTCGCAGTCCTTCCAGGTTCTAGCGATCCTCTTCGCCACGCTCGTCTACGCCGTCGTCTACGGCTACCGCTTCTGGACCGCCATCGGCCTCCGTGGCGCCTGCTTCCCCTTCGTCCTCAGCTGCCAGATCGCGCTCCTGGCATGCAATATCGCCTGCCACGTCGCCGTCTTCTTCCTCCACTTCTTCCTCAAAGGCGGGTGCAACGGCATCGGCGCGTGGCTCTTCAACTCAATCCTAAACCTCGCGCTTCTCATGCTCTTTCTTAACTTCTACGTCAGAATGCACGTGGTTCACAAGAGGAGGAAAGTTAGGGATGTTGTCGTTGCTCCTGCACTGTCTTAA
>Glyma.02g059300.1.p sequence-type=predicted peptide transcript=Glyma.02g059300.1 locus=Glyma.02g059300 ID=Glyma.02g059300.1.Wm82.a2.v1 annot-version=Wm82.a2.v1 MILIYYLSEHPAIVGFRWSHAQSWGATWSFLFTSIASYLFLSILLHLSLSLLFRRRQIPLGPFPAVHSLSMSLVSATIFAGILLSSAAEIRDTRWFWPRSKTPLQWLLCFPLGTRPSGRVFFWSYVYYLSHFLHMFRTLLTIVRHRRLSFFHLLSHSISAFASFLWLEFSQSFQVLAILFATLVYAVVYGYRFWTAIGLRGACFPFVLSCQIALLACNIACHVAVFFLHFFLKGGCNGIGAWLFNSILNLALLMLFLNFYVRMHVVHKRRKVRDVVVAPALS*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||