|
A previous version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT1G21540.1 | AT | AMP-dependent synthetase and ligase family protein | JGI | N/A | IEA |
| PTHR24095 | Panther | FAMILY NOT NAMED | JGI | N/A | IEA |
| PTHR24095:SF26 | Panther | JGI | N/A | IEA | |
| PWY-1121 | SoyCyc9 | suberin monomers biosynthesis | Plant Metabolic Network | ISS | |
| PWY-321 | SoyCyc9 | cutin biosynthesis | Plant Metabolic Network | ISS | |
| PWY-5136 | SoyCyc9 | fatty acid β-oxidation II (peroxisome) | Plant Metabolic Network | ISS | |
| PWY-5143 | SoyCyc9 | long-chain fatty acid activation | Plant Metabolic Network | ISS | |
| PWY-5147 | SoyCyc9 | oleate biosynthesis I (plants) | Plant Metabolic Network | ISS | |
| PWY-5156 | SoyCyc9 | superpathway of fatty acid biosynthesis II (plant) | Plant Metabolic Network | ISS | |
| PWY-561 | SoyCyc9 | superpathway of glyoxylate cycle and fatty acid degradation | Plant Metabolic Network | ISS | |
| PWY-5971 | SoyCyc9 | palmitate biosynthesis II (bacteria and plants) | Plant Metabolic Network | ISS | |
| PWY-5989 | SoyCyc9 | stearate biosynthesis II (bacteria and plants) | Plant Metabolic Network | ISS | |
| PWY-6733 | SoyCyc9 | sporopollenin precursors biosynthesis | Plant Metabolic Network | ISS | |
| PWY-6803 | SoyCyc9 | phosphatidylcholine acyl editing | Plant Metabolic Network | ISS | |
| GN7V-67141 | SoyCyc9-rxn | butyrate-CoA ligase | Plant Metabolic Network | ISS |
|
Glyma.01g208500 not represented in the dataset |
Glyma.01g208500 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.
Gene information in GlycineMine developed by LIS.
Gene families from PhyloGenes.
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma01g41700 | Wm82.a1.v1.1 | IGC | As supplied by JGI |
>Glyma.01g208500.1 sequence-type=CDS polypeptide=Glyma.01g208500.1.p locus=Glyma.01g208500 ID=Glyma.01g208500.1.Wm82.a2.v1 annot-version=Wm82.a2.v1 ATGTACGAGCTCCACTTCGCCGGCGCAATTCTCAACAACATCAACACCCGCCTCTACGCCCGCACCGTCTCCGTCATCCTCCGTCATGTGAAATCCGCGCTAGTCTTCGTCGACTGCGCCTCATGCCACCTCGTCCTCGAAGCCCTATCTCTCTTCCCTGAAAACCAAAATCAACACCCAACCCTAATTCTCATCACAGACAAAATCGTGGAGAAAGAGAAAGCCTTACCCGCCGTTGATAATTTCCTCGACATCGACGAGGGGCTTGAGTGA
>Glyma.01g208500.1.p sequence-type=predicted peptide transcript=Glyma.01g208500.1 locus=Glyma.01g208500 ID=Glyma.01g208500.1.Wm82.a2.v1 annot-version=Wm82.a2.v1 MYELHFAGAILNNINTRLYARTVSVILRHVKSALVFVDCASCHLVLEALSLFPENQNQHPTLILITDKIVEKEKALPAVDNFLDIDEGLE*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||