SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma.01g208500): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma.01g208500): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma.01g208500

Feature Type:gene_model
Chromosome:Gm01
Start:54016187
stop:54016459
Source:JGI
Version:Wm82.a2.v1
High confidence:yes



A previous version of this gene model can be found here:

Annotations for Glyma.01g208500
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G21540.1AT AMP-dependent synthetase and ligase family protein JGI N/AIEA
PTHR24095Panther FAMILY NOT NAMED JGI N/AIEA
PTHR24095:SF26Panther JGI N/AIEA
PWY-1121SoyCyc9 suberin monomers biosynthesis Plant Metabolic Network ISS
PWY-321SoyCyc9 cutin biosynthesis Plant Metabolic Network ISS
PWY-5136SoyCyc9 fatty acid β-oxidation II (peroxisome) Plant Metabolic Network ISS
PWY-5143SoyCyc9 long-chain fatty acid activation Plant Metabolic Network ISS
PWY-5147SoyCyc9 oleate biosynthesis I (plants) Plant Metabolic Network ISS
PWY-5156SoyCyc9 superpathway of fatty acid biosynthesis II (plant) Plant Metabolic Network ISS
PWY-561SoyCyc9 superpathway of glyoxylate cycle and fatty acid degradation Plant Metabolic Network ISS
PWY-5971SoyCyc9 palmitate biosynthesis II (bacteria and plants) Plant Metabolic Network ISS
PWY-5989SoyCyc9 stearate biosynthesis II (bacteria and plants) Plant Metabolic Network ISS
PWY-6733SoyCyc9 sporopollenin precursors biosynthesis Plant Metabolic Network ISS
PWY-6803SoyCyc9 phosphatidylcholine acyl editing Plant Metabolic Network ISS
GN7V-67141SoyCyc9-rxn butyrate-CoA ligase Plant Metabolic Network ISS

Expression Patterns of Glyma.01g208500
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma.01g208500 not represented in the dataset
Glyma.01g208500 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

View a gene family containing related genes from other legumes at LIS

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.


View gene and ortholog information at GlycineMine

Gene information in GlycineMine developed by LIS.


Related Plant Genes

View a gene family containing related genes from other plant species at PhyloGenes

Gene families from PhyloGenes.


Gene model name correspondences to Glyma.01g208500 Gene Call Version Wm82.a2.v1
Corresponding NameAnnotation VersionEvidenceComments
Glyma01g41700 Wm82.a1.v1.1IGC As supplied by JGI


Coding sequences of Glyma.01g208500
>Glyma.01g208500.1 sequence-type=CDS polypeptide=Glyma.01g208500.1.p locus=Glyma.01g208500 ID=Glyma.01g208500.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGTACGAGCTCCACTTCGCCGGCGCAATTCTCAACAACATCAACACCCGCCTCTACGCCCGCACCGTCTCCGTCATCCTCCGTCATGTGAAATCCGCGCTAGTCTTCGTCGACTGCGCCTCATGCCACCTCGTCCTCGAAGCCCTATCTCTCTTCCCTGAAAACCAAAATCAACACCCAACCCTAATTCTCATCACAGACAAAATCGTGGAGAAAGAGAAAGCCTTACCCGCCGTTGATAATTTCCTCGACATCGACGAGGGGCTTGAGTGA
Predicted protein sequences of Glyma.01g208500
>Glyma.01g208500.1.p sequence-type=predicted peptide transcript=Glyma.01g208500.1 locus=Glyma.01g208500 ID=Glyma.01g208500.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MYELHFAGAILNNINTRLYARTVSVILRHVKSALVFVDCASCHLVLEALSLFPENQNQHPTLILITDKIVEKEKALPAVDNFLDIDEGLE*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo