|
A previous version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT3G51840.1 | AT | acyl-CoA oxidase 4 | JGI | N/A | IEA |
| GO:0008152 | GO-bp | metabolic process | EnsemblGenomes | N/A | IEA |
| GO:0055114 | GO-bp | oxidation-reduction process | EnsemblGenomes | N/A | IEA |
| GO:0055114 | GO-bp | oxidation-reduction process | JGI | N/A | IEA |
| GO:0003995 | GO-mf | acyl-CoA dehydrogenase activity | JGI | N/A | IEA |
| GO:0016491 | GO-mf | oxidoreductase activity | EnsemblGenomes | N/A | IEA |
| GO:0016627 | GO-mf | oxidoreductase activity, acting on the CH-CH group of donors | EnsemblGenomes | N/A | IEA |
| GO:0050660 | GO-mf | flavin adenine dinucleotide binding | EnsemblGenomes | N/A | IEA |
| PTHR10909 | Panther | ELECTRON TRANSPORT OXIDOREDUCTASE | JGI | N/A | IEA |
| PTHR10909:SF129 | Panther | JGI | N/A | IEA | |
| PF02770 | PFAM | Acyl-CoA dehydrogenase, middle domain | JGI | N/A | IEA |
| PWY-5136 | SoyCyc9 | fatty acid β-oxidation II (peroxisome) | Plant Metabolic Network | ISS | |
| PWY-561 | SoyCyc9 | superpathway of glyoxylate cycle and fatty acid degradation | Plant Metabolic Network | ISS | |
| PWY-6837 | SoyCyc9 | fatty acid beta-oxidation V (unsaturated, odd number, di-isomerase-dependent) | Plant Metabolic Network | ISS | |
| GN7V-57929 | SoyCyc9-rxn | acyl-CoA oxidase | Plant Metabolic Network | ISS |
|
Glyma.01G099000 not represented in the dataset |
Glyma.01G099000 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.
Gene information in GlycineMine developed by LIS.
Gene families from PhyloGenes.
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.01g099000 | Wm82.a4.v1 | ISS | As supplied by JGI |
>Glyma.01g099000.1 sequence-type=CDS polypeptide=Glyma.01g099000.1.p locus=Glyma.01g099000 ID=Glyma.01g099000.1.Wm82.a2.v1 annot-version=Wm82.a2.v1 ATGATTTGTCTCATATTACTAAGTATGAGCATGGGTTTTTGGTGGGGAACATTGTTGAACAGGCTGCAGTCAGAGATGTTCAGGAGGCTTGTGTCTATGAACGTAATTTTGAGGAGCATTGTGTGGGCTGAAGCTCGGAAGCAAAAGTATTTGCCTTCTTTGGCTCAAATGAAAGCTATAGCATGTTGGGCTTTTACTAAACTTGACTATGGAAATGATGCCAATGCTCTAAAGACCACAACAACAAAGATGGGAGGTGGTTGGATCCTTGATGGCCAAAAGAGATGGATAGGAAATAATACGTTTGCTGGTTTGTTGGTTATCTTTACTAGGAATACAACAACGAACCAAATAAATGGCTTAGGTATGGCTTTTGAAACGCATCTTGAAGGAGCTCAAAGATTTGCAGAAGGATCCTCCTATGTCATGTAG
>Glyma.01g099000.1.p sequence-type=predicted peptide transcript=Glyma.01g099000.1 locus=Glyma.01g099000 ID=Glyma.01g099000.1.Wm82.a2.v1 annot-version=Wm82.a2.v1 MICLILLSMSMGFWWGTLLNRLQSEMFRRLVSMNVILRSIVWAEARKQKYLPSLAQMKAIACWAFTKLDYGNDANALKTTTTKMGGGWILDGQKRWIGNNTFAGLLVIFTRNTTTNQINGLGMAFETHLEGAQRFAEGSSYVM*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||